You probably already hold backups of your important personal files such as photos and videos to a USB or an external hard drive.
In our near future, you will be able to store this data in DNA. THE French company Biomemory wants to make available to the public the technology that allows personal data to be stored in DNA.
Today, the company he said the availability of wallet-sized cards that store a kilobyte of text data each – the equivalent of a short email – using DNA as a storage medium. The two cards they cost around $1.000. Erfane Arwani, CEO of Biomemory, says his company's offering is a kind of experiment.
"We wanted to show that our process is ready to go out into the world," he says.
A major advantage of DNA is that it is a much denser storage medium than today's electronic media.
The Wyss Institute at Harvard estimates that a single gram of DNA can hold about 36 million copies of Avengers: Endgame.
It will also be stable over time and requires less energy than the SSDs and hard drives used in today's data centers.
Once information is encoded in DNA, no energy is required until it is retrieved using a DNA sequencer.
Biomemory promises little duration lifetime of 150 years – far longer than the lifetime provided by current digital data storage methods. Hard drives last about five years, while USB sticks last about 10 years.
The website also provides a translator-encoder of text to DNA.
The following text means iguru.gr
AGTCTCAGAGTCAGTGCCGAAGAGAGTGACTCAGTGAGAGACTCTGAACAGTCAGTGCCGAACTC
